Lehman funeral home westphalia.

Jon Michael Riley, Fruitport, Michigan, age 60, passed away on Sunday, October 16, 2022. He was born on September 10, 1962, in St. Johns, MI, grew up in Westphalia, and graduated from Pewamo-Westphalia High School in 1981. He was the son of Eugene and Audrey (Witgen) Riley. Jon was a member of Most Holy Trinity Catholic Church, a … The family will receive visitors on Tuesday evening from 6-8 p.m. and again on Wednesday from 12-2 p.m. and 6-8 p.m. at the St. Mary’s Funeral Chapel, 210 N. Westphalia Street, Westphalia. The rosary will be prayed at 11:30 a.m. on Wednesday at the funeral chapel. Online condolences may be made at www.lehmanfuneralhomes.com. Obituary published on Legacy.com by Lehman Funeral Home - Portland on Apr. 13, 2024. Adeline Josephine Schafer, of Westphalia, passed away peacefully surrounded by her family on April 11, 2024 at ...Obituary published on Legacy.com by Lehman Funeral Home - Portland on Dec. 26, 2023. ... from 2-8 p.m. with the rosary being prayed at 1:30 p.m. at the St. Mary's Funeral Chapel, 210 N. Westphalia ...Browse Westphalia local obituaries on Legacy.com. Find service information, send flowers, and leave memories and thoughts in the Guestbook for your loved one. ... Funeral Homes. Local obituaries ...

If you are in the market for a used hearse, you may be looking for a great deal. Whether you are an entrepreneur starting a funeral home business or an individual with a unique tas...When a loved one passes away, obituaries serve as a way to honor their life and inform the community about the funeral arrangements. Local funeral homes play a crucial role in crea...John “Jack” Albert Martin of Westphalia, MI passed away with family at his side on Monday, June 5th at the age of 82. Jack was a member of St. Mary's Catholic Church in Westphalia his entire life. He …

Dane Van Ells Obituary. Dane Joseph Van Ells, of Westphalia, died peacefully surrounded by his family on April 5, 2024 after a courageous battle with brain cancer. Dane was born January 9, 1997 and is one of six children to Joseph and Chasidy (Cherpes) Van Ells. He was a 2016 graduate of Pewamo - Westphalia High School and a graduate of the ... Find the obituary of Janet Ann Thelen (1943 - 2024) from Westphalia, MI. Leave your condolences to the family on this memorial page or send flowers to show you care. Find the obituary of Janet Ann Thelen (1943 - 2024) from Westphalia, MI. ... Funeral arrangement under the care of Lehman Funeral Homes. Share. Facebook Twitter …

Obituary published on Legacy.com by Lehman Funeral Home - Portland on Jul. 11, 2023. Obituary. Ryan Patrick Thelen, Jr., age 21, of Westphalia passed away July 9, 2023. He was born March 19, 2002 ...Jun 8, 2023 · Family and friends must say goodbye to their beloved John Albert Martin of Westphalia, Michigan, who passed away at the age of 82, on June 5, 2023. Leave a sympathy message to the family in the guestbook on this memorial page of John Albert Martin to show support. He was predeceased by : his parents, John M. Martin and Alvina Martin; his wife ... Rite of Committal will follow at St. Mary's Cemetery. The family will receive friends from 2:00 to 4:00 and 6:00 to 8:00 p.m. on Sunday, December 11, 2022 at the St. Mary's Funeral Chapel, 210 N. Westphalia Street, Westphalia. The rosary will be prayed at 1:30 p.m. on Sunday. The family would like to thank Masonic Pathways in Alma, The …Bertha Simon Obituary. Bertha E. Simon, of Pewamo, passed away peacefully on August 17, 2018 at the age of 97 with her loving family. She was born on July 3, 1921, in Westphalia, MI, the daughter of John and Theresia (Schmitt) Thelen. She was a faithful member of St. Joseph Catholic Church and Altar Society of Pewamo.

Feb 20, 2024 · Search obituaries and death notices from Westphalia, brought to you by Echovita.com. Discover detailed obituaries, access complete funeral service information, and express your feelings by leaving condolence messages.

The family will receive friends at the St. Mary's Funeral Chapel, 210 N. Westphalia Street, Westphalia from 2-4 and 7-9 p.m. Sunday and Monday. ... Arrangements are entrusted to the Schrauben-Lehman Funeral Home, Portland, MI. Portland, Michigan . April 4, 1978 - May 26, 2004 04/04/1978 05/26/2004. Share …

In some cultures, the gathering following a funeral is known as a luncheon, while in others, it is considered a wake. The former usually involves close loved ones of the deceased g...William Trierweiler Obituary. William Henry Trierweiler, age 85, of Portland, went to be with the Lord on Thursday, November 21, 2019. Bill was born on February 8, 1934 in Westphalia, the son of John and Olivia (Koster) Trierweiler. He was a faithful member of St. Patrick Catholic Church and the Knights of Columbus Council 2168.Louis Pline Obituary. Louis Martin Pline, of Westphalia, age 88, passed away on Saturday, February 23, 2019 with his family at his side. He was born on April 15, 1930, the son of Herman and Lillian (Miller) Pline. Louis was a member of St. Mary's Catholic Church and the Knights of Columbus #2890. He enjoyed hunting, fishing and tinkering with ...Jon Michael Riley, Fruitport, Michigan, age 60, passed away on Sunday, October 16, 2022. He was born on September 10, 1962, in St. Johns, MI, grew up in Westphalia, and graduated from Pewamo-Westphalia High School in 1981. He was the son of Eugene and Audrey (Witgen) Riley. Jon was a member of Most Holy Trinity Catholic Church, a member of the ...Jun 8, 2023 · Obituary published on Legacy.com by Lehman Funeral Home - Portland on Jun. 8, 2023. John "Jack" Albert Martin of Westphalia, MI passed away with family at his side on Monday, June 5th at the age ... Family and friends must say goodbye to their beloved John Albert Martin of Westphalia, Michigan, who passed away at the age of 82, on June 5, 2023. Leave a sympathy message to the family in the guestbook on this memorial page of John Albert Martin to show support. He was predeceased by : his parents, John M. Martin and Alvina Martin; his wife ...Browse Westphalia local obituaries on Legacy.com. Find service information, send flowers, and leave memories and thoughts in the Guestbook for your loved one.

Steven Lee Spitzley, age 80, of Portland, passed away on Sunday, April 17, 2022. He was born on April 10, 1942 the son of Edward and Marcella (Rademacher) Spitzley. Steve was a member of St. Mary’s Church in Westphalia and St. Patrick’s Church in Portland. Steve retired from General Motors after 42 years of service and was a member of the ...The family will receive friends from 2- 4 and 6-8 p.m., Tuesday, September 7, 2021 at the St. Mary’s Funeral Chapel, 210 N. Westphalia Street, Westphalia. The rosary will be prayed at 1:30 p.m. on Tuesday at the chapel. Memorial contributions may be made to St. Mary’s School in memory of Donald. Arrangements are entrusted to Lehman …Here is when and how to view the main funeral services for the 41st president of the US. George H.W. Bush, the 41st US president, died last Friday (Nov. 30), aged 94. Memorial serv...Joan Cook Obituary. Joan R. Cook, of Pewamo, Michigan, passed away peacefully surrounded by her family on February 14, 2023 at the age of 92. She was born in Westphalia, Michigan on June 14, 1930 to Mathias and Mary (Belen) Kloeckner. Joan was a loving wife, mother, and grandmother. She was a devoted member of St. Joseph …The family will receive friends on Thursday from 2-8 p.m. with a rosary being prayed at 1:30 p.m. at the St. Mary’s Funeral Chapel, 210 N. Westphalia Street, Westphalia. Arrangements are entrusted to Lehman Funeral …Obituary. Gene Pohl, age 66, of Westphalia, went to be with the Lord on Monday, August 15, 2022. He was born on May 12, 1956 to Bernard and Harriet (Smith) Pohl. Gene and his surviving wife of 43 years, Theresa (Wieber) Pohl, took great pride in their family. Gene greatly enjoyed his sons and daughters-in-laws: Adam & Lindsay Pohl …

If you are in the market for a used hearse, you may be looking for a great deal. Whether you are an entrepreneur starting a funeral home business or an individual with a unique tas...Richard H. Hengesbach, age 73, passed away surrounded by his family on Thursday, July 12, 2018. He was born March 15, 1945 in Westphalia, the son of Gilbert E. and Clothilda M. (Hufnagel) Hengesbach. Richard was a member of St. Mary Catholic Church and the Michigan National Guard. He was a lifelong farmer and retired from Fisher Body after 34 ...

Obituaries and service information to be coming soon! Thank you for visiting Lehman Funeral Homes of Ionia and Portland web site. Ionia Chapel: 220 Rich Street, Ionia, MI 48846 Phone: (616) 527-2250 Fax: (616) 527-3440. Portland Chapel: 210 E. Bridge Street, Portland, MI 48875 Phone: (517) 647-7995 Fax: (517) 647-6009. Whether you have recently ... Visit Their Website. Details Recent Obituaries Upcoming Services. Read Lehman Funeral Homes obituaries, find service information, send sympathy gifts, or plan and price a funeral in Portland, MI.When a loved one passes away, obituaries serve as a way to honor their life and inform the community about the funeral arrangements. Local funeral homes play a crucial role in crea...Death, Age Birth Date Birth Place, Burial Notes, Funeral Home ... Westphalia, Germany, Lindenwood, Klaehn. Wiebke ... Lehman Cem., Payne, OH, Sloan. Wilson, ...Virginia "Ginny" Weber Obituary. Virginia "Ginny" Agnes Weber, age 64 of Westphalia, MI passed away on Saturday, December 23rd from a hard fought battle with cancer. Ginny …Hilda Ann Schmitz Obituary. We are sad to announce that on February 28, 2024, at the age of 86, Hilda Ann Schmitz of Westphalia, Michigan passed away. Family and friends are welcome to leave their condolences on this memorial page and share them with the family. She was predeceased by : her sisters-in-law, Alice Hoover and Trudy Schafer (Jerome ... Paul Downes Obituary. Paul Andrew Downes, 61, of Westphalia, passed away on December 11, 2021 after a tragic battle with COVID-19. He was born on March 23, 1960, the son of William and Loretta (Hogan) Downes. Paul was a faithful member of St. Joseph Catholic Church, where he also contributed his singing talents as a cantor for Mass. Find 3 listings related to Schrauben Lehman Funeral Home in Westphalia on YP.com. See reviews, photos, directions, phone numbers and more for Schrauben Lehman Funeral Home locations in Westphalia, MI. ... MI with Schrauben Lehman Funeral Home. Eagle (10 miles) Portland (11 miles) Fowler (12 miles) Pewamo (13 miles) Related Categories …Rite of Committal will follow at St Mary Catholic Cemetery. The family will receive friends from 3:00 p.m. to 7:30 p.m. on Wednesday, May 2, 2018 at St Mary’s Funeral Chapel, 210 N. Westphalia St. The rosaries will be prayed at 2:30 p.m. and 7:30 p.m. at the funeral chapel. Arrangements are entrusted to Lehman Funeral Home, Portland, Michigan.

The family will receive friends 7-9 p.m., Monday and 2-4 and 7-9 p.m., Tuesday at St. Mary's Funeral Chapel, 210 N. Westphalia St.. The rosaries will be prayed at 8 p.m., Monday and 3 p.m., Tuesday. A Scriptural Wake Service will be held at 8 p.m., Tuesday. Arrangements are entrusted to Schrauben-Lehman Funeral Homes, Portland.

Hilda Ann Schmitz Obituary. We are sad to announce that on February 28, 2024, at the age of 86, Hilda Ann Schmitz of Westphalia, Michigan passed away. Family and friends are welcome to leave their condolences on this memorial page and share them with the family. She was predeceased by : her sisters-in-law, Alice Hoover and Trudy Schafer (Jerome ...

Losing a loved one is an emotional and challenging experience. During this difficult time, it is important to find a funeral home that can provide compassionate and personalized se...Dane Van Ells Obituary. Dane Joseph Van Ells, of Westphalia, died peacefully surrounded by his family on April 5, 2024 after a courageous battle with brain cancer. Dane was born January 9, 1997 and is one of six children to Joseph and Chasidy (Cherpes) Van Ells. He was a 2016 graduate of Pewamo - Westphalia High School and a graduate of the ...The family will receive friends at the St. Mary's Funeral Chapel, 210 N. Westphalia Street, Westphalia from 7-9 p.m. Sunday and 2-4 and 7-9 p.m. Monday. The rosary will be prayed at 8 p.m. Sunday and 3 p.m. Monday. There will be a Scriptural Wake Service held at 8 p.m. Monday. Arrangements are entrusted to the Schrauben-Lehman …Herman Schneider Obituary. 82, of Westphalia, died Tuesday. Services 11 a.m. Friday at St. Mary Catholic Church, Westphalia. Arrangements by Schrauben-Lehman Funeral Home, Portland. Published by ...Obituary published on Legacy.com by Lehman Funeral Home - Portland on Jun. 8, 2023. John "Jack" Albert Martin of Westphalia, MI passed away with family at his side on Monday, June 5th at the age ...John T. Rhines offers a wide range of services to honor your wishes, traditions and customs to include: Direct Cremation. Domestic Shipping. Funeral …Visitation will be held on Friday from 4-8 p.m. with a rosary being prayed at 7:00 p.m. at the St. Mary's Funeral Chapel, 210 N. Westphalia Street, Westphalia. ... Arrangements are entrusted to Lehman Funeral Homes. Online condolences may be made at www.lehmanfuneralhomes.com. To send flowers to the family or plant a tree in memory …Obituaries and service information to be coming soon! Thank you for visiting Lehman Funeral Homes of Ionia and Portland web site. Ionia Chapel: 220 Rich Street, Ionia, MI 48846 Phone: (616) 527-2250 Fax: (616) 527-3440. Portland Chapel: 210 E. Bridge Street, Portland, MI 48875 Phone: (517) 647-7995 Fax: (517) 647-6009. Whether you have recently ...A deadly service. To most of us, managing the departure of the dying is an odd business but it might also be a deadly one. Researchers from Harvard University have found that funer...The family will receive friends at the St. Mary's Funeral Chapel, 210 N. Westphalia Street, Westphalia from 2-4 and 7-9 p.m. Sunday and Monday. The rosaries will be prayed at 3 and 8 p.m. both days. Arrangements are entrusted to the Schrauben-Lehman Funeral Home, Portland, MI. Portland, MichiganKevin Fedewa Obituary. Kevin James Fedewa, age 57. April 10, 1963 – August 15, 2020. After a courageous 21 month battle with kidney cancer, Kevin Fedewa’s suffering is now over as he is greeted by our Savior at the gates of heaven. He fought with grace and class every step of the way as he taught our children how to accept life’s ...Obituary for Dennis Carl Smith | Dennis Carl Smith, age 74, of Westphalia, passed away June 19, 2019 surrounded...

Hilda Ann Schmitz Obituary. We are sad to announce that on February 28, 2024, at the age of 86, Hilda Ann Schmitz of Westphalia, Michigan passed away. Family and friends are welcome to leave their condolences on this memorial page and share them with the family. She was predeceased by : her sisters-in-law, Alice Hoover and Trudy Schafer (Jerome ...The Mass of Christian Burial will be celebrated by Rev. Eric Weber at 10:30 a.m., Friday, May 19, 2023 at St. Mary’s Church, Westphalia. Rite of Committal will follow at St. Mary’s Cemetery. The family will receive friends 2-8 p.m., Thursday, May 18, 2023 at the St. Mary’s Funeral Chapel, 210 N. Westphalia St.August 28, 1937 - October 1, 2023. Danny C. Arens, a beloved husband, father, grandfather, and friend, passed away on October 1, 2023, at the age of 86. Born on August 28, 1937, in Portland, Michigan, he was the son of Roman and Eleanor (Koster) Arens. Danny was a devoted family man who found joy in both his work and leisure.Instagram:https://instagram. xfinity voice guidance turn offjigga boo jigga boois the bone from bar rescue still opencit bank contact The Mass of Christian Burial will be celebrated by Rev. Eric Weber at 10:30 a.m., Friday, May 19, 2023 at St. Mary’s Church, Westphalia. Rite of Committal will follow at St. Mary’s Cemetery. The family will receive friends 2-8 p.m., Thursday, May 18, 2023 at the St. Mary’s Funeral Chapel, 210 N. Westphalia St. what is wrong with the following piece of mrna taccaggatcactttgccagood feet store little rock arkansas Margaret Wohlfert Obituary. Margaret M. Wohlfert, age 96, of Westphalia, passed away peacefully surrounded by her family on Wednesday, April 7, 2021. She was born in Westphalia on February 26, 1925, the daughter of Arthur and Rosalia (Schueller) Smith. Margaret was a faithful member of St. Mary’s Catholic Church, the Christian Mother’s ... psa dagger for sale Joan Cook Obituary. Joan R. Cook, of Pewamo, Michigan, passed away peacefully surrounded by her family on February 14, 2023 at the age of 92. She was born in Westphalia, Michigan on June 14, 1930 to Mathias and Mary (Belen) Kloeckner. Joan was a loving wife, mother, and grandmother. She was a devoted member of St. Joseph …It may sound morbid, but writing your own obituary and considering the way you want to be remembered by your friends and loved ones is an excellent way to get perspective on what y...Family and friends must say goodbye to their beloved John Albert Martin of Westphalia, Michigan, who passed away at the age of 82, on June 5, 2023. Leave a sympathy message to the family in the guestbook on this memorial page of John Albert Martin to show support. He was predeceased by : his parents, John M. Martin and Alvina Martin; his wife ...